Abstract: Spartina is the most invasive alien plant along the coast of China, which has seriously threatened the biodiversity and ecosystem stability in coastal zone. In order to identify the species of Spartina in Zhuanghe coastal zone of the Northern Yellow Sea, and put forward targeted control measures, in this paper, the species was identified using molecular detection technology. PCR amplification was performed from total DNA of fresh plant leaves using primers S65-F/S65-R and universal primers ITS. Among them, S65 forward rimer sequence is 5’-ACACTACCCTGATCATCCTCT-3’ and S65 reverse primer sequence is 5’-TCTGGCTGGATTGTTGTCTGT-3’. The universal primers are ITS1(TCCGTAGGTGAACCTGCGG) and ITS4(TCCTCCGCTTATTGATATGA).The results showed that Spartina was identified as Spartina anglica in Zhuanghe coastal zone of the Northern Yellow Sea. It is suggested that local governments should strengthen the prevention and control of Spartina anglica and carry out comprehensive management in view of the impacts of Spartina anglica invasion on biodiversity and coastal ecosystems.